Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCTCTATAAATTCTTTCTGGGAC[G/T]GGTCTGTTACTTTCTTTTTGGTATG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611143 MIM: 606769 MIM: 611983 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM175A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM175A - family with sequence similarity 175 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HELQ - helicase, POLQ-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297755.1 | Intron | NP_001284684.1 | ||||
NM_001297756.1 | Intron | NP_001284685.1 | ||||
NM_001297757.1 | Intron | NP_001284686.1 | ||||
NM_001297758.1 | Intron | NP_001284687.1 | ||||
NM_001297759.1 | Intron | NP_001284688.1 | ||||
NM_133636.3 | Intron | NP_598375.2 | ||||
XM_005262711.1 | Intron | XP_005262768.1 | ||||
XM_005262713.2 | Intron | XP_005262770.1 | ||||
XM_006714076.2 | Intron | XP_006714139.1 | ||||
XM_011531580.2 | Intron | XP_011529882.1 | ||||
XM_017007679.1 | Intron | XP_016863168.1 | ||||
XM_017007680.1 | Intron | XP_016863169.1 | ||||
XM_017007681.1 | Intron | XP_016863170.1 | ||||
XM_017007682.1 | Intron | XP_016863171.1 | ||||
XM_017007683.1 | Intron | XP_016863172.1 |
MRPS18C - mitochondrial ribosomal protein S18C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297767.1 | Intron | NP_001284696.1 | ||||
NM_001297769.1 | Intron | NP_001284698.1 | ||||
NM_001297770.1 | Intron | NP_001284699.1 | ||||
NM_016067.3 | Intron | NP_057151.1 |