Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCAGGGACATCCTCCTCATATGA[A/G]GCATTAAGGCACATGCTGTACTGTG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 603551 MIM: 605082 MIM: 607052 | |||||||||||||||||||||||
Literature Links: |
HYAL2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
HYAL2 - hyaluronoglucosaminidase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RASSF1 - Ras association domain family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206957.1 | 1613 | UTR 3 | NP_001193886.1 | |||
NM_007182.4 | 1613 | UTR 3 | NP_009113.3 | |||
NM_170712.2 | 1613 | UTR 3 | NP_733830.1 | |||
NM_170713.2 | 1613 | UTR 3 | NP_733831.1 | |||
NM_170714.1 | 1613 | UTR 3 | NP_733832.1 | |||
XM_011533315.1 | 1613 | UTR 3 | XP_011531617.1 | |||
XM_011533316.2 | 1613 | UTR 3 | XP_011531618.1 |
RASSF1-AS1 - RASSF1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUSC2 - tumor suppressor candidate 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |