Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCATCCCCTTTTGTTTCCTGAAG[A/G]GAAGGACTACTTGCTCACAATGCTT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608619 | |||||||||||||||||||||||
Literature Links: |
FAM3D PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
FAM3D - family with sequence similarity 3 member D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138805.2 | Intron | NP_620160.1 | ||||
XM_005264862.4 | Intron | XP_005264919.1 | ||||
XM_005264863.4 | Intron | XP_005264920.1 | ||||
XM_005264864.4 | Intron | XP_005264921.1 | ||||
XM_006712965.3 | Intron | XP_006713028.1 | ||||
XM_006712967.3 | Intron | XP_006713030.1 | ||||
XM_011533348.2 | Intron | XP_011531650.1 | ||||
XM_011533349.2 | Intron | XP_011531651.1 | ||||
XM_011533350.2 | Intron | XP_011531652.1 | ||||
XM_011533351.2 | Intron | XP_011531653.1 | ||||
XM_011533352.2 | Intron | XP_011531654.1 | ||||
XM_011533353.2 | Intron | XP_011531655.1 | ||||
XM_011533354.2 | Intron | XP_011531656.1 |
FAM3D-AS1 - FAM3D antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |