Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTTCCTGTGTTATCTTTTTTTTTT[A/T]AACACCCAATTTCAATAGGCCCTAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605766 MIM: 605661 | ||||||||||||||||||||
Literature Links: |
DLEU2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DLEU2 - deleted in lymphocytic leukemia 2 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3613 - microRNA 3613 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIM13 - tripartite motif containing 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007278.2 | Intron | NP_001007279.1 | ||||
NM_005798.4 | Intron | NP_005789.2 | ||||
NM_052811.3 | Intron | NP_434698.1 | ||||
NM_213590.2 | Intron | NP_998755.1 |