Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCTTAAAGTCTTACCTGAGGGTGA[C/T]ATCACCTCCACGCTCAAAGTTCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605272 MIM: 616956 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR6717 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR6717 - microRNA 6717 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDRG2 - NDRG family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282211.1 | 863 | Missense Mutation | ATC,GTC | I,V 247 | NP_001269140.1 | |
NM_001282212.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_001269141.1 | |
NM_001282213.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_001269142.1 | |
NM_001282214.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_001269143.1 | |
NM_001282215.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | NP_001269144.1 | |
NM_001282216.1 | 863 | Missense Mutation | ATC,GTC | I,V 191 | NP_001269145.1 | |
NM_001320329.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | NP_001307258.1 | |
NM_016250.2 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_057334.1 | |
NM_201535.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | NP_963293.1 | |
NM_201536.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_963294.1 | |
NM_201537.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | NP_963831.1 | |
NM_201538.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_963832.1 | |
NM_201539.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | NP_963833.1 | |
NM_201540.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | NP_963834.1 | |
NM_201541.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | NP_963835.1 | |
XM_011536996.2 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_011535298.1 | |
XM_011536997.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_011535299.1 | |
XM_011536998.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_011535300.1 | |
XM_011536999.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_011535301.1 | |
XM_011537001.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_011535303.1 | |
XM_011537002.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_011535304.1 | |
XM_017021480.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876969.1 | |
XM_017021481.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876970.1 | |
XM_017021482.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876971.1 | |
XM_017021483.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876972.1 | |
XM_017021484.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876973.1 | |
XM_017021485.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876974.1 | |
XM_017021486.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876975.1 | |
XM_017021487.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876976.1 | |
XM_017021488.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876977.1 | |
XM_017021489.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876978.1 | |
XM_017021490.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876979.1 | |
XM_017021491.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876980.1 | |
XM_017021492.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876981.1 | |
XM_017021493.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876982.1 | |
XM_017021494.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876983.1 | |
XM_017021495.1 | 863 | Missense Mutation | ATC,GTC | I,V 251 | XP_016876984.1 | |
XM_017021496.1 | 863 | Missense Mutation | ATC,GTC | I,V 237 | XP_016876985.1 | |
XM_017021497.1 | 863 | Missense Mutation | ATC,GTC | I,V 73 | XP_016876986.1 |
TPPP2 - tubulin polymerization promoting protein family member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |