Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCACTGAAGCAAAAATTTCCAGTGA[C/T]GTCTAAATCTTAGGGGTAAAATTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 107830 MIM: 603930 MIM: 603207 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARG2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARG2 - arginase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPHN - gephyrin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024218.1 | Intron | NP_001019389.1 | ||||
NM_020806.4 | Intron | NP_065857.1 | ||||
XM_005267254.3 | Intron | XP_005267311.1 | ||||
XM_011536340.2 | Intron | XP_011534642.1 | ||||
XM_011536342.2 | Intron | XP_011534644.1 | ||||
XM_011536343.2 | Intron | XP_011534645.1 | ||||
XM_011536344.2 | Intron | XP_011534646.1 | ||||
XM_011536345.2 | Intron | XP_011534647.1 | ||||
XM_011536346.2 | Intron | XP_011534648.1 | ||||
XM_011536347.2 | Intron | XP_011534649.1 | ||||
XM_017020913.1 | Intron | XP_016876402.1 | ||||
XM_017020914.1 | Intron | XP_016876403.1 | ||||
XM_017020915.1 | Intron | XP_016876404.1 | ||||
XM_017020916.1 | Intron | XP_016876405.1 | ||||
XM_017020917.1 | Intron | XP_016876406.1 | ||||
XM_017020918.1 | Intron | XP_016876407.1 | ||||
XM_017020919.1 | Intron | XP_016876408.1 | ||||
XM_017020920.1 | Intron | XP_016876409.1 | ||||
XM_017020921.1 | Intron | XP_016876410.1 | ||||
XM_017020922.1 | Intron | XP_016876411.1 | ||||
XM_017020923.1 | Intron | XP_016876412.1 | ||||
XM_017020924.1 | Intron | XP_016876413.1 | ||||
XM_017020925.1 | Intron | XP_016876414.1 | ||||
XM_017020926.1 | Intron | XP_016876415.1 |
VTI1B - vesicle transport through interaction with t-SNAREs 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006370.2 | Intron | NP_006361.1 |