Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CAGGGCTAGGGTGTTCTTCCAGTAC[A/C]GGAGGCCTCGGAAGAAGTGCAGAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611709 MIM: 611710 MIM: 611708 MIM: 611711 MIM: 611896 | ||||||||||||||||||||
Literature Links: |
MIR127 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR127 - microRNA 127 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR136 - microRNA 136 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR337 - microRNA 337 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR431 - microRNA 431 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR432 - microRNA 432 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR433 - microRNA 433 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR665 - microRNA 665 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RTL1 - retrotransposon-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134888.2 | 3310 | Missense Mutation | CGG,CTG | R,L 1084 | NP_001128360.1 |