Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATTCCCGGGGTCACAACTCCTCCA[A/C]CAGCCCCTCTCTCCAAGCTGGAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610500 MIM: 602711 MIM: 603483 MIM: 603819 | ||||||||||||||||||||
Literature Links: |
ANKHD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKHD1 - ankyrin repeat and KH domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ANKHD1-EIF4EBP3 - ANKHD1-EIF4EBP3 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020690.5 | 7944 | Missense Mutation | AAC,ACC | N,T 2597 | NP_065741.3 |
APBB3 - amyloid beta precursor protein binding family B member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF4EBP3 - eukaryotic translation initiation factor 4E binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003732.2 | 7944 | Missense Mutation | ACA,CCA | T,P 72 | NP_003723.1 |
SRA1 - steroid receptor RNA activator 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |