Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGTGCCCACTTAACTGTGAAAA[A/G]GATATTTGTTGGTGGCATTAAAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604478 MIM: 164017 MIM: 601490 | ||||||||||||||||||||
Literature Links: |
CBX5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CBX5 - chromobox 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HNRNPA1 - heterogeneous nuclear ribonucleoprotein A1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002136.3 | 429 | Intron | NP_002127.1 | |||
NM_031157.3 | 429 | Intron | NP_112420.1 | |||
XM_005268826.1 | 429 | Missense Mutation | AAG,AGG | K,R 106 | XP_005268883.1 | |
XM_017019251.1 | 429 | Intron | XP_016874740.1 |
NFE2 - nuclear factor, erythroid 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |