Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGGGGTGAAGGAACAGGAATCCA[A/G]CAAATATTAAGAGGACAAACTTTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614215 MIM: 607988 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ASCC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ASCC1 - activating signal cointegrator 1 complex subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198798.2 | 2206 | UTR 3 | NP_001185727.1 | |||
NM_001198799.2 | 2206 | UTR 3 | NP_001185728.1 | |||
NM_001198800.2 | 2206 | UTR 3 | NP_001185729.1 | |||
XM_006717873.3 | 2206 | Intron | XP_006717936.1 | |||
XM_011539841.2 | 2206 | Intron | XP_011538143.1 | |||
XM_011539842.2 | 2206 | Intron | XP_011538144.1 | |||
XM_017016291.1 | 2206 | Intron | XP_016871780.1 | |||
XM_017016292.1 | 2206 | Intron | XP_016871781.1 | |||
XM_017016293.1 | 2206 | Intron | XP_016871782.1 | |||
XM_017016294.1 | 2206 | Intron | XP_016871783.1 | |||
XM_017016295.1 | 2206 | Intron | XP_016871784.1 | |||
XM_017016296.1 | 2206 | Intron | XP_016871785.1 | |||
XM_017016297.1 | 2206 | Intron | XP_016871786.1 | |||
XM_017016298.1 | 2206 | Intron | XP_016871787.1 | |||
XM_017016299.1 | 2206 | Intron | XP_016871788.1 | |||
XM_017016300.1 | 2206 | Intron | XP_016871789.1 | |||
XM_017016301.1 | 2206 | Intron | XP_016871790.1 | |||
XM_017016302.1 | 2206 | Intron | XP_016871791.1 | |||
XM_017016303.1 | 2206 | Intron | XP_016871792.1 |
SPOCK2 - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |