Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCACAATGTGTTCTGTGTTCTTCTC[A/G]TTTTCTTTGTCTTTATGGGAGAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
20 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606753 | ||||||||||||||||||||
Literature Links: |
MROH7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MROH7 - maestro heat like repeat family member 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MROH7-TTC4 - MROH7-TTC4 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC4 - tetratricopeptide repeat domain 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291333.1 | Intron | NP_001278262.1 | ||||
NM_004623.4 | Intron | NP_004614.3 |