Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTATACTTAGGAGCAATTGGGTA[A/G]GCAAACCTTAAAACCGTCAGAATTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
21 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600716 MIM: 615858 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AP4B1-AS1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AP4B1-AS1 - AP4B1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPN22 - protein tyrosine phosphatase, non-receptor type 22 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193431.2 | Intron | NP_001180360.1 | ||||
NM_001308297.1 | Intron | NP_001295226.1 | ||||
NM_012411.5 | Intron | NP_036543.4 | ||||
NM_015967.6 | Intron | NP_057051.3 | ||||
XM_011541221.1 | Intron | XP_011539523.1 | ||||
XM_011541222.1 | Intron | XP_011539524.1 | ||||
XM_011541223.2 | Intron | XP_011539525.1 | ||||
XM_011541225.2 | Intron | XP_011539527.1 | ||||
XM_017001004.1 | Intron | XP_016856493.1 | ||||
XM_017001005.1 | Intron | XP_016856494.1 | ||||
XM_017001006.1 | Intron | XP_016856495.1 |
RSBN1 - round spermatid basic protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |