Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCAAACTTTGTGCAGTCCTCATG[A/G]TCTTCCTGTTGCTGTTGGGCCAGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604417 MIM: 601918 MIM: 611373 MIM: 612080 | ||||||||||||||||||||
Literature Links: |
AFF4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AFF4 - AF4/FMR2 family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GDF9 - growth differentiation factor 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LEAP2 - liver enriched antimicrobial peptide 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052971.2 | 63 | Missense Mutation | ATC,GTC | I,V 12 | NP_443203.1 |
UQCRQ - ubiquinol-cytochrome c reductase complex III subunit VII | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |