Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCCGCGACCGCGCCAAGGCCAGG[A/G]TCCGGAGCGTCCCGCAAGGCGGCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615880 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARHGAP39 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARHGAP39 - Rho GTPase activating protein 39 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308207.1 | 187 | Intron | NP_001295136.1 | |||
NM_001308208.1 | 187 | Intron | NP_001295137.1 | |||
NM_025251.2 | 187 | Intron | NP_079527.1 | |||
XM_011517308.1 | 187 | Intron | XP_011515610.1 | |||
XM_011517309.1 | 187 | Intron | XP_011515611.1 | |||
XM_011517312.2 | 187 | Intron | XP_011515614.1 | |||
XM_017013870.1 | 187 | Intron | XP_016869359.1 | |||
XM_017013871.1 | 187 | Intron | XP_016869360.1 |
C8orf82 - chromosome 8 open reading frame 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001795.1 | 187 | Missense Mutation | ACC,ATC | T,I 10 | NP_001001795.1 |
LRRC14 - leucine rich repeat containing 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC24 - leucine rich repeat containing 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |