Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATTTAACTAAGCAGCTGCCAGAAG[A/C]TATGAGTCGTTTCTTCTACTTTCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612675 | ||||||||||||||||||||
Literature Links: |
FSD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FSD2 - fibronectin type III and SPRY domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007122.3 | Intron | NP_001007123.1 | ||||
NM_001281805.1 | Intron | NP_001268734.1 | ||||
NM_001281806.1 | Intron | NP_001268735.1 | ||||
XM_005272425.4 | Intron | XP_005272482.1 | ||||
XM_011521235.2 | Intron | XP_011519537.1 | ||||
XM_017021924.1 | Intron | XP_016877413.1 |
SCARNA15 - small Cajal body-specific RNA 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNHG21 - small nucleolar RNA host gene 21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |