Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGGCAGGGTGGCTGTTGTTATT[G/T]GTGAAGATAGGCATCTAGCCAGAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606148 MIM: 600393 | ||||||||||||||||||||
Literature Links: |
FADS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FADS1 - fatty acid desaturase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013402.4 | 1303 | Missense Mutation | AAA,CAA | K,Q 501 | NP_037534.3 | |
XM_011545022.2 | 1303 | Missense Mutation | AAA,CAA | K,Q 430 | XP_011543324.1 |
FEN1 - flap structure-specific endonuclease 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR611 - microRNA 611 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM258 - transmembrane protein 258 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |