Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTCCTGAAAGTCAGAATCTGATT[G/T]GTCCAGCTGGATCAGGTGTCCTCTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 191740 MIM: 606435 MIM: 606428 MIM: 606429 MIM: 606430 MIM: 606431 MIM: 606432 MIM: 606433 MIM: 606434 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MROH2A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MROH2A - maestro heat like repeat family member 2A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001287395.1 | 1572 | Intron | NP_001274324.1 | |||
XM_011511075.2 | 1572 | Intron | XP_011509377.1 | |||
XM_011511076.2 | 1572 | Intron | XP_011509378.1 | |||
XM_011511077.2 | 1572 | Intron | XP_011509379.1 | |||
XM_011511078.2 | 1572 | Intron | XP_011509380.1 | |||
XM_011511079.2 | 1572 | Intron | XP_011509381.1 | |||
XM_011511080.2 | 1572 | UTR 5 | XP_011509382.1 | |||
XM_011511081.2 | 1572 | Intron | XP_011509383.1 | |||
XM_011511082.2 | 1572 | Intron | XP_011509384.1 | |||
XM_011511083.2 | 1572 | Intron | XP_011509385.1 | |||
XM_011511084.2 | 1572 | Intron | XP_011509386.1 | |||
XM_011511085.2 | 1572 | Intron | XP_011509387.1 | |||
XM_011511086.2 | 1572 | Intron | XP_011509388.1 |
UGT1A1 - UDP glucuronosyltransferase family 1 member A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A10 - UDP glucuronosyltransferase family 1 member A10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A3 - UDP glucuronosyltransferase family 1 member A3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A4 - UDP glucuronosyltransferase family 1 member A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A5 - UDP glucuronosyltransferase family 1 member A5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A6 - UDP glucuronosyltransferase family 1 member A6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A7 - UDP glucuronosyltransferase family 1 member A7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A8 - UDP glucuronosyltransferase family 1 member A8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UGT1A9 - UDP glucuronosyltransferase family 1 member A9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |