Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCTACTCTCATATTCTGTATCCA[A/G]TATATTTTGTTGGGTCCTTTTGATT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 189962 | |||||||||||||||||||||||
Literature Links: |
GTF2E1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
GTF2E1 - general transcription factor IIE subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005513.2 | Intron | NP_005504.2 | ||||
XM_011512744.2 | Intron | XP_011511046.1 | ||||
XM_011512745.2 | Intron | XP_011511047.1 |
RABL3 - RAB, member of RAS oncogene family like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |