Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTGTAGCCCATCGTCCCCCAGCA[C/T]TGATAGCACACAGTGTCTGCCTGTT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608308 MIM: 616627 | |||||||||||||||||||||||
Literature Links: |
ABTB1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ABTB1 - ankyrin repeat and BTB domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032548.3 | Intron | NP_115937.1 | ||||
NM_172027.2 | Intron | NP_742024.1 | ||||
XM_006713769.3 | Intron | XP_006713832.1 | ||||
XM_011513213.1 | Intron | XP_011511515.1 | ||||
XM_017007285.1 | Intron | XP_016862774.1 | ||||
XM_017007286.1 | Intron | XP_016862775.1 | ||||
XM_017007287.1 | Intron | XP_016862776.1 | ||||
XM_017007288.1 | Intron | XP_016862777.1 |
PODXL2 - podocalyxin like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |