Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACTCAGATATAAATTTAACAAAA[C/T]ATAAAAACTAGAAAACACCAGTGAA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||
Literature Links: |
LRRC31 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LRRC31 - leucine rich repeat containing 31 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001277127.1 | Intron | NP_001264056.1 | ||||
NM_001277128.1 | Intron | NP_001264057.1 | ||||
NM_024727.3 | Intron | NP_079003.2 | ||||
XM_011513158.2 | Intron | XP_011511460.1 | ||||
XM_011513159.2 | Intron | XP_011511461.1 | ||||
XM_011513160.2 | Intron | XP_011511462.1 | ||||
XM_017007204.1 | Intron | XP_016862693.1 |
LRRIQ4 - leucine rich repeats and IQ motif containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |