Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATTATGATCGAACATACAAACTGT[A/G]CCTGAATCTGCGGTATACAATTTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609986 MIM: 604181 | ||||||||||||||||||||
Literature Links: |
CARD6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CARD6 - caspase recruitment domain family member 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100506548 - uncharacterized LOC100506548 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL37 - ribosomal protein L37 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000997.4 | Intron | NP_000988.1 |
SNORD72 - small nucleolar RNA, C/D box 72 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |