Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACTTTTAGATACTTCAGTATGTCT[C/G]TTTTTTTAAAAAAATGATTTTCCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603139 MIM: 600822 | ||||||||||||||||||||
Literature Links: |
AK6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AK6 - adenylate kinase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAD17 - RAD17 checkpoint clamp loader component | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278622.1 | Intron | NP_001265551.1 | ||||
NM_002873.1 | Intron | NP_002864.1 | ||||
NM_133338.2 | Intron | NP_579916.1 | ||||
NM_133339.2 | Intron | NP_579917.1 | ||||
NM_133340.2 | Intron | NP_579918.1 | ||||
NM_133341.2 | Intron | NP_579919.1 | ||||
NM_133342.2 | Intron | NP_579920.1 | ||||
NM_133343.1 | Intron | NP_579921.1 | ||||
NM_133344.2 | Intron | NP_579922.1 | ||||
XM_017009679.1 | Intron | XP_016865168.1 | ||||
XM_017009680.1 | Intron | XP_016865169.1 | ||||
XM_017009681.1 | Intron | XP_016865170.1 |
TAF9 - TATA-box binding protein associated factor 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |