Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGACCTACACGGAGCACGCCAAGC[A/G]CAAGACGGTCACCGCCATGGACGTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615012 MIM: 615013 MIM: 615044 MIM: 615045 MIM: 602833 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HIST1H2AG PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HIST1H2AG - histone cluster 1, H2ag | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2AH - histone cluster 1, H2ah | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2BJ - histone cluster 1, H2bj | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2BK - histone cluster 1, H2bk | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001312653.1 | 236 | Intron | NP_001299582.1 | |||
NM_080593.2 | 236 | Intron | NP_542160.1 |
HIST1H4I - histone cluster 1, H4i | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003495.2 | 236 | Missense Mutation | CAC,CGC | H,R 79 | NP_003486.1 |
MIR3143 - microRNA 3143 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |