Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTAAAACCTATGTCTACTGTAGA[C/G]AGCTCTGGTGACTTCATTTCCTTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615231 MIM: 605976 | ||||||||||||||||||||
Literature Links: |
RC3H2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RC3H2 - ring finger and CCCH-type domains 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB26 - zinc finger and BTB domain containing 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB6 - zinc finger and BTB domain containing 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006626.5 | 702 | Silent Mutation | CTC,CTG | L,L 205 | NP_006617.1 |