Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGTGAAGAGTTCAACACAGCAAA[A/C]AGGCAGGCAGCTCCTTTGTATATGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615417 MIM: 609146 MIM: 604481 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BET1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BET1L - Bet1 golgi vesicular membrane trafficking protein like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6743 - microRNA 6743 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RIC8A - RIC8 guanine nucleotide exchange factor A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIRT3 - sirtuin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001017524.2 | 1482 | UTR 3 | NP_001017524.1 | |||
NM_012239.5 | 1482 | UTR 3 | NP_036371.1 | |||
XM_005252835.1 | 1482 | UTR 3 | XP_005252892.1 | |||
XM_011519956.1 | 1482 | UTR 3 | XP_011518258.1 | |||
XM_011519957.1 | 1482 | UTR 3 | XP_011518259.1 | |||
XM_017017428.1 | 1482 | UTR 3 | XP_016872917.1 | |||
XM_017017429.1 | 1482 | UTR 3 | XP_016872918.1 | |||
XM_017017430.1 | 1482 | UTR 3 | XP_016872919.1 | |||
XM_017017431.1 | 1482 | UTR 3 | XP_016872920.1 |