Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGTGTGGGCACTTTGACGGTGTTG[T/C]CAAACTTGGAGTAGTCCACAGAGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600509 MIM: 600937 MIM: 613714 | ||||||||||||||||||||
Literature Links: |
ABCC8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCC8 - ATP binding cassette subfamily C member 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNJ11 - potassium voltage-gated channel subfamily J member 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000525.3 | 1198 | Missense Mutation | GAC,GGC | D,G 334 | NP_000516.3 | |
NM_001166290.1 | 1198 | Missense Mutation | GAC,GGC | D,G 247 | NP_001159762.1 | |
XM_006718226.3 | 1198 | Missense Mutation | GAC,GGC | D,G 247 | XP_006718289.1 | |
XM_017017680.1 | 1198 | Missense Mutation | GAC,GGC | D,G 247 | XP_016873169.1 |
NCR3LG1 - natural killer cell cytotoxicity receptor 3 ligand 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |