Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACTGGGATCCCCACCTTGGACAA[C/T]CTCCAGAAGGGAGTCCAATTTGCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601074 MIM: 603846 MIM: 609538 | ||||||||||||||||||||
Literature Links: |
CELF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CELF1 - CUGBP, Elav-like family member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KBTBD4 - kelch repeat and BTB domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFS3 - NADH:ubiquinone oxidoreductase core subunit S3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPMT1 - protein tyrosine phosphatase, mitochondrial 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001143984.1 | 523 | Intron | NP_001137456.1 | |||
NM_175732.2 | 523 | Silent Mutation | AAC,AAT | N,N 110 | NP_783859.1 |