Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGTGACTTCCAGAACAATTCGCG[C/T]GTACCATGGAAAGTTGAGCCACAGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM234B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM234B - family with sequence similarity 234 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GSG1 - germ cell associated 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080554.2 | 1438 | UTR 3 | NP_001074023.1 | |||
NM_001080555.2 | 1438 | UTR 3 | NP_001074024.1 | |||
NM_001206842.1 | 1438 | UTR 3 | NP_001193771.1 | |||
NM_001206843.1 | 1438 | UTR 3 | NP_001193772.1 | |||
NM_001206845.1 | 1438 | UTR 3 | NP_001193774.1 | |||
NM_031289.3 | 1438 | UTR 3 | NP_112579.2 | |||
NM_153823.3 | 1438 | UTR 3 | NP_722545.2 | |||
XM_005253493.2 | 1438 | Intron | XP_005253550.1 | |||
XM_005253495.1 | 1438 | Intron | XP_005253552.1 | |||
XM_011520858.1 | 1438 | Intron | XP_011519160.1 | |||
XM_011520859.1 | 1438 | Intron | XP_011519161.1 | |||
XM_011520860.1 | 1438 | Intron | XP_011519162.1 | |||
XM_011520861.1 | 1438 | Intron | XP_011519163.1 | |||
XM_011520862.1 | 1438 | Intron | XP_011519164.1 | |||
XM_011520863.1 | 1438 | Intron | XP_011519165.1 |