Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCAAGAGGTTATTTGCTACACAC[C/T]ATGGGTGGTTTATTGTCCAGATTAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600005 MIM: 611303 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CIITA PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CIITA - class II, major histocompatibility complex, transactivator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLEC16A - C-type lectin domain family 16 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243403.1 | Intron | NP_001230332.1 | ||||
NM_015226.2 | Intron | NP_056041.1 | ||||
XM_005255210.1 | Intron | XP_005255267.1 | ||||
XM_005255211.1 | Intron | XP_005255268.1 | ||||
XM_005255213.1 | Intron | XP_005255270.1 | ||||
XM_005255214.1 | Intron | XP_005255271.1 | ||||
XM_005255215.3 | Intron | XP_005255272.1 | ||||
XM_005255216.1 | Intron | XP_005255273.1 | ||||
XM_006720870.3 | Intron | XP_006720933.1 | ||||
XM_011522434.1 | Intron | XP_011520736.1 | ||||
XM_011522435.1 | Intron | XP_011520737.1 | ||||
XM_011522436.2 | Intron | XP_011520738.1 | ||||
XM_011522437.2 | Intron | XP_011520739.1 | ||||
XM_011522438.2 | Intron | XP_011520740.1 | ||||
XM_011522439.2 | Intron | XP_011520741.1 | ||||
XM_011522440.2 | Intron | XP_011520742.1 | ||||
XM_017023089.1 | Intron | XP_016878578.1 | ||||
XM_017023090.1 | Intron | XP_016878579.1 |
DEXI - Dexi homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |