Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGACGGCCCCCCCGCGCCCCCCG[C/G]CGCGCCGCAGGCGCCGTCCCCGCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614620 | ||||||||||||||||||||
Literature Links: |
CRAMP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CRAMP1 - cramped chromatin regulator homolog 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020825.3 | 191 | Missense Mutation | GCC,GGC | A,G 64 | NP_065876.3 |
IFT140 - intraflagellar transport 140 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371046 - uncharacterized LOC105371046 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |