Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCATCCTGGTCCTCTCAGGAAAG[G/T]GGGGCGTTGGGAAAAGCACCATCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610886 MIM: 601489 MIM: 610779 MIM: 611659 | ||||||||||||||||||||
Literature Links: |
EME2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EME2 - essential meiotic structure-specific endonuclease subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IGFALS - insulin like growth factor binding protein acid labile subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUBP2 - nucleotide binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284501.1 | 168 | UTR 5 | NP_001271430.1 | |||
NM_001284502.1 | 168 | UTR 5 | NP_001271431.1 | |||
NM_012225.3 | 168 | Missense Mutation | GGG,TGG | G,W 24 | NP_036357.1 | |
XM_005255027.2 | 168 | UTR 5 | XP_005255084.1 | |||
XM_005255030.1 | 168 | UTR 5 | XP_005255087.1 | |||
XM_011522338.2 | 168 | Missense Mutation | GGG,GTG | G,V 33 | XP_011520640.1 | |
XM_017022831.1 | 168 | UTR 5 | XP_016878320.1 | |||
XM_017022832.1 | 168 | Missense Mutation | GGG,GTG | G,V 44 | XP_016878321.1 |
SPSB3 - splA/ryanodine receptor domain and SOCS box containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |