Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCTGGCCCGGGGACGCCTGGCCC[C/G]CGCCACCGACTGTGACCAGATCTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609899 MIM: 614578 MIM: 602474 | ||||||||||||||||||||
Literature Links: |
KREMEN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KREMEN2 - kringle containing transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253725.1 | 865 | Intron | NP_001240654.1 | |||
NM_001253726.1 | 865 | Intron | NP_001240655.1 | |||
NM_024507.3 | 865 | Missense Mutation | CCC,CGC | P,R 187 | NP_078783.1 | |
NM_172229.2 | 865 | Missense Mutation | CCC,CGC | P,R 187 | NP_757384.1 |
PAQR4 - progestin and adipoQ receptor family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PKMYT1 - protein kinase, membrane associated tyrosine/threonine 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |