Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGAGTAGCTATTTGTGAACTCGC[G/T]TTGATTTTTTCTTTACTATCTCGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603020 | ||||||||||||||||||||
Literature Links: |
AFG3L1P PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AFG3L1P - AFG3 like matrix AAA peptidase subunit 1, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CENPBD1 - CENPB DNA-binding domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145039.3 | 1105 | Missense Mutation | AAA,AAC | K,N 65 | NP_659476.2 |
DEF8 - differentially expressed in FDCP 8 homolog (mouse) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |