Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCCACCTCCTGCTGCAGCTCCGC[C/T]TTCTGCTTCTCCAGCTCCTCCTTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602020 MIM: 179035 MIM: 606212 | ||||||||||||||||||||
Literature Links: |
MAFG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MAFG - MAF bZIP transcription factor G | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002359.3 | 462 | Silent Mutation | AAA,AAG | K,K 83 | NP_002350.1 | |
NM_032711.3 | 462 | Silent Mutation | AAA,AAG | K,K 83 | NP_116100.2 | |
XM_011523578.1 | 462 | Silent Mutation | AAA,AAG | K,K 83 | XP_011521880.1 |
MAFG-AS1 - MAFG antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PYCR1 - pyrroline-5-carboxylate reductase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIRT7 - sirtuin 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |