Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTCTTCGTTTGTATATTTCCTAC[C/T]TTGTACACAGGCTCTTCCAGAGCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603825 MIM: 610016 MIM: 613487 MIM: 610963 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HIC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HIC1 - hypermethylated in cancer 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001098202.1 | 2979 | UTR 3 | NP_001091672.1 | |||
NM_006497.3 | 2979 | UTR 3 | NP_006488.2 |
MIR132 - microRNA 132 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR212 - microRNA 212 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMG6 - SMG6, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256827.1 | 2979 | Intron | NP_001243756.1 | |||
NM_001256828.1 | 2979 | Intron | NP_001243757.1 | |||
NM_001282326.1 | 2979 | Intron | NP_001269255.1 | |||
NM_017575.4 | 2979 | Intron | NP_060045.4 | |||
XM_005256569.3 | 2979 | Intron | XP_005256626.1 | |||
XM_005256570.3 | 2979 | Intron | XP_005256627.1 | |||
XM_005256571.4 | 2979 | Intron | XP_005256628.1 | |||
XM_011523769.2 | 2979 | Intron | XP_011522071.1 | |||
XM_011523772.2 | 2979 | Intron | XP_011522074.1 | |||
XM_011523773.2 | 2979 | Intron | XP_011522075.1 | |||
XM_011523774.2 | 2979 | Intron | XP_011522076.1 | |||
XM_011523775.2 | 2979 | Intron | XP_011522077.1 | |||
XM_017024398.1 | 2979 | Intron | XP_016879887.1 | |||
XM_017024399.1 | 2979 | Intron | XP_016879888.1 |