Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGTTTTGAGAACAGAGTGCTGTT[A/T]TAGAGCTGGCAGCAGCATCTCAGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606676 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LRRC75A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LRRC75A - leucine rich repeat containing 75A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001113567.2 | Intron | NP_001107039.1 | ||||
NM_207387.3 | Intron | NP_997270.2 | ||||
XM_011523845.2 | Intron | XP_011522147.1 | ||||
XM_017024619.1 | Intron | XP_016880108.1 | ||||
XM_017024620.1 | Intron | XP_016880109.1 |
LRRC75A-AS1 - LRRC75A antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD49A - small nucleolar RNA, C/D box 49A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD49B - small nucleolar RNA, C/D box 49B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD65 - small nucleolar RNA, C/D box 65 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRPV2 - transient receptor potential cation channel subfamily V member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |