Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGAGATTGAAATGTAGTTTCTTTG[A/C]AGGTTATATTCCCAGAGGATGTCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606676 | ||||||||||||||||||||
Literature Links: |
LRRC75A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LRRC75A - leucine rich repeat containing 75A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001113567.2 | Intron | NP_001107039.1 | ||||
NM_207387.3 | Intron | NP_997270.2 | ||||
XM_011523845.2 | Intron | XP_011522147.1 | ||||
XM_017024619.1 | Intron | XP_016880108.1 | ||||
XM_017024620.1 | Intron | XP_016880109.1 |
LRRC75A-AS1 - LRRC75A antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD49A - small nucleolar RNA, C/D box 49A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD49B - small nucleolar RNA, C/D box 49B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD65 - small nucleolar RNA, C/D box 65 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRPV2 - transient receptor potential cation channel subfamily V member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |