Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCATTGAATCTCTTCTGGAAAACC[G/T]GGAGCAGAGAAGATGAGACTGGATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614144 MIM: 602521 MIM: 600596 | ||||||||||||||||||||
Literature Links: |
B9D1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
B9D1 - B9 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK7 - mitogen-activated protein kinase 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFAP4 - microfibrillar associated protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198695.1 | Intron | NP_001185624.1 | ||||
NM_002404.2 | Intron | NP_002395.1 |