Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGTTTGGTTTTTCTTGTTTTCCAA[A/G]GTGCTGGAGTGAAAATTCTACCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611425 MIM: 604111 MIM: 610969 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CNTROB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CNTROB - centrobin, centriole duplication and spindle assembly protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037144.5 | Intron | NP_001032221.1 | ||||
NM_053051.3 | Intron | NP_444279.2 | ||||
XM_005256437.2 | Intron | XP_005256494.1 | ||||
XM_005256438.2 | Intron | XP_005256495.1 | ||||
XM_005256439.2 | Intron | XP_005256496.1 | ||||
XM_017024128.1 | Intron | XP_016879617.1 | ||||
XM_017024129.1 | Intron | XP_016879618.1 | ||||
XM_017024130.1 | Intron | XP_016879619.1 | ||||
XM_017024131.1 | Intron | XP_016879620.1 | ||||
XM_017024132.1 | Intron | XP_016879621.1 | ||||
XM_017024133.1 | Intron | XP_016879622.1 | ||||
XM_017024134.1 | Intron | XP_016879623.1 | ||||
XM_017024135.1 | Intron | XP_016879624.1 | ||||
XM_017024136.1 | Intron | XP_016879625.1 | ||||
XM_017024137.1 | Intron | XP_016879626.1 | ||||
XM_017024138.1 | Intron | XP_016879627.1 | ||||
XM_017024139.1 | Intron | XP_016879628.1 | ||||
XM_017024140.1 | Intron | XP_016879629.1 | ||||
XM_017024141.1 | Intron | XP_016879630.1 | ||||
XM_017024142.1 | Intron | XP_016879631.1 | ||||
XM_017024143.1 | Intron | XP_016879632.1 | ||||
XM_017024144.1 | Intron | XP_016879633.1 |
KCNAB3 - potassium voltage-gated channel subfamily A regulatory beta subunit 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAPPC1 - trafficking protein particle complex 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |