Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCACCGGATGCCACCCTCTACTTC[A/G]ATGTGGTTCTGCTGGATGTGTGGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607063 | ||||||||||||||||||||
Literature Links: |
FKBP10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FKBP10 - FK506 binding protein 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021939.3 | 752 | Missense Mutation | AAT,GAT | N,D 143 | NP_068758.3 | |
XM_011525099.2 | 752 | Missense Mutation | AAT,GAT | N,D 143 | XP_011523401.1 | |
XM_011525100.2 | 752 | Missense Mutation | AAT,GAT | N,D 52 | XP_011523402.1 |
NT5C3B - 5'-nucleotidase, cytosolic IIIB | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P3H4 - prolyl 3-hydroxylase family member 4 (non-enzymatic) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |