Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGGGGCCGGCGGGGGCAGCCGCGG[C/G]GGGGTTGAGGCCCTGAGGGGCAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600240 MIM: 602346 | ||||||||||||||||||||
Literature Links: |
CCR10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCR10 - C-C motif chemokine receptor 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016602.2 | 1014 | Missense Mutation | CCC,CGC | P,R 337 | NP_057686.2 |
CNTNAP1 - contactin associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003632.2 | 1014 | Intron | NP_003623.1 | |||
XM_005257748.4 | 1014 | Intron | XP_005257805.1 | |||
XM_017025238.1 | 1014 | Intron | XP_016880727.1 |
PLEKHH3 - pleckstrin homology, MyTH4 and FERM domain containing H3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |