Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGAGCTGCAGCAGGCCTTGTCCGC[T/G]CTGAAGCAGGCGGGCGGCGCGCGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607732 MIM: 610975 MIM: 616815 MIM: 193190 | ||||||||||||||||||||
Literature Links: |
SARM1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SARM1 - sterile alpha and TIR motif containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015077.3 | 605 | Silent Mutation | GCG,GCT | A,A 78 | NP_055892.2 |
SEBOX - SEBOX homeobox | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM199 - transmembrane protein 199 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VTN - vitronectin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |