Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGACGTGCACTGAATAGATGGCGTC[A/G]TCCTCTAGCTCCTGGGGATGTTAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608434 | ||||||||||||||||||||
Literature Links: |
ABHD15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABHD15 - abhydrolase domain containing 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GIT1 - GIT ArfGAP 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001085454.1 | 1837 | Silent Mutation | GAC,GAT | D,D 550 | NP_001078923.1 | |
NM_014030.3 | 1837 | Silent Mutation | GAC,GAT | D,D 541 | NP_054749.2 | |
XM_011524684.1 | 1837 | Silent Mutation | GAC,GAT | D,D 550 | XP_011522986.1 | |
XM_011524685.1 | 1837 | Silent Mutation | GAC,GAT | D,D 541 | XP_011522987.1 |
TP53I13 - tumor protein p53 inducible protein 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |