Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATAGCTGTAAAGACAGTAGTGGCTG[C/G]TGGACGGCGGCTCGAGTCTCCGCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603428 | ||||||||||||||||||||
Literature Links: |
C17orf75 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C17orf75 - chromosome 17 open reading frame 75 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022344.3 | 192 | Missense Mutation | ACC,AGC | T,S 35 | NP_071739.2 | |
XM_005258022.3 | 192 | Missense Mutation | ACC,AGC | T,S 27 | XP_005258079.1 | |
XM_017024940.1 | 192 | Intron | XP_016880429.1 | |||
XM_017024941.1 | 192 | Intron | XP_016880430.1 |
MIR632 - microRNA 632 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF207 - zinc finger protein 207 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |