Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAATGTTTCAATCCTTTTTACTTC[G/T]GCAGCTGTGTGCTCTGCCGTCATCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606834 MIM: 605859 | ||||||||||||||||||||
Literature Links: |
KMT2B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KMT2B - lysine methyltransferase 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB32 - zinc finger and BTB domain containing 32 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001316902.1 | Intron | NP_001303831.1 | ||||
NM_001316903.1 | Intron | NP_001303832.1 | ||||
NM_014383.2 | Intron | NP_055198.1 | ||||
XM_011526718.2 | Intron | XP_011525020.1 | ||||
XM_017026588.1 | Intron | XP_016882077.1 | ||||
XM_017026589.1 | Intron | XP_016882078.1 | ||||
XM_017026590.1 | Intron | XP_016882079.1 | ||||
XM_017026591.1 | Intron | XP_016882080.1 | ||||
XM_017026592.1 | Intron | XP_016882081.1 |