Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCTAGGTGGAGGCATGAGAAGG[C/T]CTTGGCCTAGCCCTCCAGGGTCCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 165161 MIM: 600538 MIM: 606034 | ||||||||||||||||||||
Literature Links: |
JUNB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
JUNB - JunB proto-oncogene, AP-1 transcription factor subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5684 - microRNA 5684 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRDX2 - peroxiredoxin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005809.5 | Intron | NP_005800.3 |
RNASEH2A - ribonuclease H2 subunit A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |