Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGTGTCCAGGGACATCACCGGAC[C/T]GCAGGCAGCCCCCTCTGCCTTCCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609809 MIM: 609493 MIM: 614639 | ||||||||||||||||||||
Literature Links: |
LIME1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LIME1 - Lck interacting transmembrane adaptor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001305654.1 | 806 | Silent Mutation | ACC,ACT | T,T 101 | NP_001292583.1 | |
NM_001305655.1 | 806 | Silent Mutation | ACC,ACT | T,T 101 | NP_001292584.1 | |
NM_017806.3 | 806 | Missense Mutation | CCG,CTG | P,L 113 | NP_060276.2 |
SLC2A4RG - SLC2A4 regulator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB46 - zinc finger and BTB domain containing 46 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZGPAT - zinc finger CCCH-type and G-patch domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |