Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCATTGGAAGATGCCCCTTCCAGCC[A/G]GTGCCCTCCTGCCTGGGGACCTGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605737 MIM: 612873 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BIRC7 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BIRC7 - baculoviral IAP repeat containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FLJ16779 - uncharacterized LOC100192386 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107985425 - uncharacterized LOC107985425 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_017028201.1 | 966 | Silent Mutation | CCA,CCG | P,P 210 | XP_016883690.1 |
MIR3196 - microRNA 3196 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NKAIN4 - Na+/K+ transporting ATPase interacting 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152864.3 | 966 | Intron | NP_690603.3 | |||
XM_005260192.1 | 966 | Intron | XP_005260249.1 | |||
XM_005260194.3 | 966 | Intron | XP_005260251.1 | |||
XM_011528527.1 | 966 | Intron | XP_011526829.1 | |||
XM_011528528.2 | 966 | Intron | XP_011526830.1 | |||
XM_011528529.2 | 966 | Intron | XP_011526831.1 | |||
XM_017027636.1 | 966 | Intron | XP_016883125.1 | |||
XM_017027637.1 | 966 | Intron | XP_016883126.1 | |||
XM_017027638.1 | 966 | Intron | XP_016883127.1 | |||
XM_017027639.1 | 966 | Intron | XP_016883128.1 |