Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAATTCAAGCCATCCACTGTCCAAC[G/T]AACAGTTCTAGAAAGAGAATAGAAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
DZANK1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DZANK1 - double zinc ribbon and ankyrin repeat domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099407.1 | Intron | NP_001092877.1 | ||||
XM_005260742.3 | Intron | XP_005260799.1 | ||||
XM_005260743.3 | Intron | XP_005260800.1 | ||||
XM_006723584.2 | Intron | XP_006723647.1 | ||||
XM_011529268.2 | Intron | XP_011527570.1 | ||||
XM_011529271.2 | Intron | XP_011527573.1 | ||||
XM_011529272.2 | Intron | XP_011527574.1 | ||||
XM_011529275.2 | Intron | XP_011527577.1 | ||||
XM_011529277.2 | Intron | XP_011527579.1 | ||||
XM_017027909.1 | Intron | XP_016883398.1 | ||||
XM_017027910.1 | Intron | XP_016883399.1 | ||||
XM_017027911.1 | Intron | XP_016883400.1 | ||||
XM_017027912.1 | Intron | XP_016883401.1 | ||||
XM_017027913.1 | Intron | XP_016883402.1 | ||||
XM_017027914.1 | Intron | XP_016883403.1 | ||||
XM_017027915.1 | Intron | XP_016883404.1 | ||||
XM_017027916.1 | Intron | XP_016883405.1 | ||||
XM_017027917.1 | Intron | XP_016883406.1 | ||||
XM_017027918.1 | Intron | XP_016883407.1 | ||||
XM_017027919.1 | Intron | XP_016883408.1 | ||||
XM_017027920.1 | Intron | XP_016883409.1 | ||||
XM_017027921.1 | Intron | XP_016883410.1 |
LINC00851 - long intergenic non-protein coding RNA 851 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |