Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTGGGCTGTTTGTGTGCAGGTCC[C/T]GTGGTGATAGGCTGGGGGTCAGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612770 MIM: 612765 | ||||||||||||||||||||
Literature Links: |
MIR7109 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR7109 - microRNA 7109 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PISD - phosphatidylserine decarboxylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001326411.1 | Intron | NP_001313340.1 | ||||
NM_001326412.1 | Intron | NP_001313341.1 | ||||
NM_001326413.1 | Intron | NP_001313342.1 | ||||
NM_001326414.1 | Intron | NP_001313343.1 | ||||
NM_001326415.1 | Intron | NP_001313344.1 | ||||
NM_001326416.1 | Intron | NP_001313345.1 | ||||
NM_001326417.1 | Intron | NP_001313346.1 | ||||
NM_001326418.1 | Intron | NP_001313347.1 | ||||
NM_001326419.1 | Intron | NP_001313348.1 | ||||
NM_001326420.1 | Intron | NP_001313349.1 | ||||
NM_001326421.1 | Intron | NP_001313350.1 | ||||
NM_014338.3 | Intron | NP_055153.1 | ||||
NM_178022.1 | Intron | NP_821141.1 |
SFI1 - SFI1 centrin binding protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |